Impact of sheep and goat pox lesions on skin quality

]

Introduction

Ethiopia has a huge livestock population in Africa, possessing more than 56.7 million cattle, 29.3 million sheep, 29.1 million goats, 1.5 million camels, 7 million equines and 52 million chickens.1 This makes Ethiopia stand second next to Nigeria, by the number of small ruminants in Africa.2 Annually, 16.6 million small ruminant skins are produced in the country, among these 33% and 32.5% were obtained from sheep and goats, respectively.3 Despite a huge potential of off take rates; the production of high-quality skins was curtailed.4,5

Fish, birds, and reptiles, as well as wild and domesticated animals, can provide hides and skins. Cattle, sheep, and goats are the most important sources of hide and skin in Ethiopia. In 1998/99, the potential production is projected to 2.38 million cow hides, 10.07 million sheep skins, and 7.38 million goatskins based on annual off-take rates of 7% for cattle, 33% for sheep, and 35% for goats. This leather industry’s raw material is mostly obtained from rural parts of the country where basic facilities for slaughtering and subsequent marketing are either non-existent or non-existent. Hide obtained from cattle, as well as skins obtained from goats and sheep, are country’s major items that account for the vast majority of agricultural export commodities followed by live animals.6

Sheep and goats play a substantial role in the gross domestic product of the countryto date, the benefits gained from these small ruminants are fraught by different constraints. Livestock diseases are amongst the significant practical precincts that have slowed down the progress of the livestock sector by decreasing production and impeding the trade of live animal and animal products.7,8 Among these infectious diseases, sheep and goat pox are the main problem and widely spread diseases in all regions of Ethiopia.2

More than 35% of sheep and 56% of goat skins have downgraded and rejected due to pre- and post-slaughter defects. The majority of defects are caused by pre- and post-slaughter defects due to skin diseases and poor because of various antemortem and postmortem defects caused by poor animal husbandry and nutrition, skin diseases and parasites, improper slaughter and flaying operations and improper practices of curing, collection, transportation and storage.9 Tanneries state that only 10% to 15% of harvested skins qualify for top grades, with the rest downgraded and rejected mainly due to deterioration of skin quality owing to skin diseases and various defects.10 Sheep and goat pox is among the disease which is responsible for deterioration of the quality of skin.

Sheep and goat pox virus (SGPV) is highly contagious viral disease of sheep and goats, in the genus Capripox virus (CaPV), subfamily Chordopoxvirinae, and family Poxviridae.11 The sheep pox virus (SPPV), goat pox virus (GTPV), and lumpy skin disease virus (LSDV) showed 96% nucleotide and amino acid similarity over their entire length.12 The central genomic region surrounded by two identical inverted terminal repeats (ITR) at the ends of SGPV (ORFs 024 to 123) comprises homologues of conserved genes involved in basic replication systems as well as in viral DNA replication, transcription, RNA modification, and structure and assembly of intracellular mature and extracellular enveloped virions.12–14 While the terminal open reading frame (ORF) (001 to 023 and 124 to156) contain genes involving with virulence, host immune evasion and host range functions.12 Mature virion cell attachment (P32) comprises the main antigenic determinants which are important for the pathogenicity and diagnosis of the virus.15

In endemic areas losses due to SGP include the direct loss; mortality, and the indirect losses include reduced milk yield, weight loss, increased abortion rates, damage to skin, and increased susceptibility to pneumonia and fly strike.16

The effect of SGPV on the skin is very high. Lesions developed secondary to virus invasion of the epithelium, ischemic necrosis produced by vascular damage and stimulates the host cell DNA replication which causes epidermal hyperplasia.17 The epidermis shows hydropic degeneration and ruptured vesicles at some places exposing the dermis.18 Edema, fibroblast proliferation, and accumulation of cellular exudates in the stained section of the dermis.19 Extravasations of erythrocytes and coagulative necrosis with effusion of inflammatory cells intermixed with tissue debris was noticed in the hypodermis.18 The impact of these pathogenesis mechanisms of the virus may also affect the tannery industry in countries like Ethiopia where leather is the largest source of foreign currency. Now days, the current foreign trade revenue of hide and skin has dropped by 9–10% on domestic and export markets.20 In Ethiopia, it is projected that a higher proportion of skin defects are developed ante-mortem.5,21 Among infectious diseases, sheep and goat pox are the major trait for the small ruminant sector and the second largest cause of skin rejection next to parasitic causes.22 Skin grades on skin collected from different areas of Ethiopia showed that greater than 85% hide was rejected due to pox and less than 6% was graded 1–4.22 The main aim of this research is to assess the impact of SGP in warehouses and the quality impacts of SGP on skin in ware houses.

Materials and Methods

Study Area

The research was conducted in West Shewa, East and west Arsi. Arsi Negele is located in the west Arsi zone of Oromia regional state. Arsi Negele is located at a longitude of 7°21ʹ N and latitude of 38°42ʹE and 2043 meters above sea level. Ziway is located at the longitude of 7°56ʹ N and latitude of 38°43ʹ E and 1636 meters above sea level. Dhera is located 30 Km away from Adama on the highway connecting Adama to Assela. Dhera is located at the longitude of 8°15ʹ N and latitude of 39°20ʹ E and 2430 meters above sea level1 (CSA, 2015). These areas receive bimodal rainfall and local farmers practice rain feed agriculture and also practice irrigation.

Sample Size

A cluster sampling method was applied to identify skin defects from skins collected from three districts. Sample size was estimated according to Thrusfield,23 the sample size was 384 where an expected prevalence of 50% is to be estimated with a desired absolute precision of ±5%. To maximize the accuracy of the data produced by the survey, we sampled more than the average.

Study Design

Three (each with a potential of collecting >5000 skins per annum) private skin collection shades/stores were purposively selected based on proximity to the transport access. Twenty percent of the warehouses’ sheep and goat skins (fresh, salted or air-dried skins) were selected using a simple random sampling method. Complete physical examination was performed on randomly selected skins and data were recorded to generate information related to sheep and goat pox like; distribution of the lesion, lesion type, size, and skin grade. The skin was categorized by size, preservation methods (fresh, salted, and air dried) and skin defects caused by sheep and goat pox.24 Skin inspection was made by day light to check for any defects.

Laboratory Examination

Skin biopsies for virus genome detection were collected from skin lesions and placed in a sterile screw-capped test tubes and placed immediately on an icebox and then in –20°C and sent to the department of Molecular biology in National Veterinary Institute (NVI), Ethiopia, for molecular diagnosis.25 Skin tissues were rinsed with phosphate buffered saline 3 times. Skin tissues were analyzed, minced with a sterile scissor and crushed with a sterile pestle and mortar as described by Mangana-Vougiouka et al.26,27 The viral genomic DNA extraction was done using the QIAamp DNA Mini Kit (QIAGEN, Hilden, Germany) using the manufacturer’s instructions as a base and finally the DNA was eluted using 50μL elution buffer. The PCR was conducted using RNA polymerase 30KDa (RPO30) primers: Forward primer 5ʹ TCTATGTTCTTGATATGTGGTGGTAG 3ʹ and Reverse primer 5ʹ AGTGATTAGGTGGTGTATTATTTTCC 3ʹ. Polymerase chain reaction (PCR) was carried out in a 25μL reaction volume in a 200μL capacity PCR tube containing 12.5μLMaxima Hot Start Green PCR Master Mix (QIAGEN, Hilden, Germany), 0.5μL of each primer (10pmol/μL), 1μL of extracted DNA and 10.5μL of nuclease free water. The amplification was performed according to Lamien et al28 in a thermocycler (Eppendorf AG, Hamburg, Germany) adjusted as denaturation (95°C for 4 min), followed by 35 cycles of denaturation (95°C for 30 sec), annealing (55°C for 30 sec) and extension (72°C for 30 sec) and final extension (72°C for 5 min). Three percent ultrapure, electrophoresis grade agarose gel containing 1μg/mL Ethidium Bromide in TAE buffer, was prepared and casted in a mold. When the gel was completely solidified, the combs was removed carefully and the gel was placed in the electrophoresis tank containing 1X TAE running buffer before loading the samples. In the centre of the first well, 5μL of 100bp DNA ladder was loaded, while in the remaining wells, 6μL of sample DNA with 2μL of DNA loading dye (50% glycerol, 6x TAE, 1% bromophenol blue) was loaded by using micropipettes. After electrophoresis on 3% agarose gel (1hr at 100V) the PCR product was visualized on a UV Transilluminator (UVtec, Cambridge, UK).

Data Analysis

The data was collected by a pretested questionnaire and filled in a spread sheet Excel analysis was by using SPSS version 24 (SPSS. Inc.) and a significant association between variables was said to exist if the computed P-value is ≤0.05. Student’s t-test was applied to see the difference between species, preservatives used and study area.

Results

A total of 2014 skins (998 sheep skin and 1016 goat skin) were examined during the study period (Table 1). The prevalence of SGP in warehouse was 4.02% (n= 81). The vast majority of the SPG lesions were scars (n=45), followed by nodules and papule (n=19) and (n=13), respectively. According to Ethiopian Standard Authority (ESA, 2012), only a small proportion of shoat skins drop in the extra small (1%), very small (11.56%), and extra-large category (0.145%). Large proportion of shoat skin were categorized under the small (21.6%), medium (31.1%), large (25.76%), and very large (8.6%) categories.

Table 1 The Distribution of SGP in Terms of Spp., Size, Study Area, Preservation and Lesion Types

Despite a large number of SGP, positive skins fall in small, medium, and large categories; there was no substantial variance between different sizes and SGP (P.0.05) as shown in table. However, there was a significant difference between species (χ2=8.314; P=0.016) and study area (χ2=53.647; P=0.000).

As depicted in Table 2 SGP was responsible for an epic downgrading of skin (n= 27, 1.3% fall in grade 5) and rejection of skin (n=21, 1%), and usually a large proportion of the affected skin fall in grades 4, 5, 6 and reject category. Among rejected skins (n=79), 25% was due to SGP (Table 2). Furthermore, there is a strong correlation and association between skin down grading and SGP (P < 0.05).

Table 2 The Impact of SGP on the Total Grade of the Skin

All samples, whether it was collected from sheep or goat, were given a 172 bp sized DNA product during RPO30 gene amplification. All samples, whether it was collected from sheep or goat, were given a 172bp sized DNA product during RPO30 gene amplification. RPO30 gene of SPPV has 151bp size while the GTPV and LSDV have 172bp size.

Discussion

A lot of works done on skin quality fail to describe problems that can downgrade skin quality infectious diseases like sheep and goat pox (SGP). This study discloses the most significant aspects of SGP in the quality of skin in warehouses.29 Epithelial regeneration from the underneath of the scab takes several weeks. The disease causes irreversible damage to the skin and a star-shaped, hairless or wool less scar is formed. The scar affects the grain side of the skin.30

The total prevalence of SGP in warehouses in this study was 4.02%; 2.28% and 1.69% of the pox lesion was observed on fresh skin and salted skin, respectively. Our finding is in line with other findings.21,31 Kahsay et al21 documented that the prevalence of SGP in salted skin and dry skin was 15% and 6.8%, respectively. While Tsigab et al31 reported that the prevalence of pox lesion was 3.6% and 4% in dry skin and wet skin, respectively. Pox lesions were observed more often on wet blue goat skins (10.8%) and wet blue hides (8.1%) than in pickled sheep skins (1.2%).21

In Tannery-based studies conducted in Bahirdar tannery and Modjo export tannery, the prevalence of SGP was 10%32 and 9.5%.33 Usually, the prevalence of SGP lesions in tanneries is by far larger than that of warehouses. After the tanning process, fully recovered lesions become more protuberant in the form of white spots on the skin and usually confusing Cokkel scars.30

In Ethiopia, very limited work has been done on sheep and goat pox virus but some researches have been made on participatory disease surveillance (PDS) in selected districts of Afar region and Northeastern part of Ethiopia and central Ethiopia Gari et al34 and seroprevalence and distribution of sheep and goat pox virus in Northwest Amhara region Ethiopia were reported by Fentie et al.2 Furthermore, isolation and characterization of poxvirus was done by Demena35 in west Shoa and central Ethiopia. A report on epidemiology and economic importance of sheep and goat pox is highly distributed in all regions of Ethiopia and economically important due to production loss and mortality.8,2

According to Assefa et al,32 large and very large skins are highly affected and 90% of the affected skin classified in the reject category. However, in our study, a substantial number of skin fell in grade 2, 4, and rejected category (69.13%). A study conducted in Punjab, Pakistan, old lesions of pox are the second largest skin and hide problem followed by skin atrophy.19 However, in our study, the proportion of SGP was 4.02%. Pox accounted for 1.5%, 15.5%, 6.8% and 8.3% of pickled sheep skins, wet blue or salted goat skins, wet blue or dry goat skins and wet blue hides, respectively, being rejected.21

Sheep and goat pox (SGP) is a highly transmissible viral disease that results in an extensive loss in the production and productivity of small ruminants in Ethiopia. Regarding the status of the disease in Ethiopia, SGP was endemic in almost all the regions of Ethiopia.34,35 In Ethiopia, a total of 57,638 small ruminants contracted the disease and more than 4.8 million of them were at risk in areas where outbreaks occurred. Out of the 57,638 sick small ruminants, 6,401 animals died with a case fatality rate of 11.11%. Only about 35–40% the disease was reported in Ethiopia; the actual figures in terms of affected, vaccinated and dead animals are expected to be higher than the reported numbers. Although there were no detailed studies on the prevalence of SGP in Ethiopia, some reports indicate that it is one of the widely distributed and it is the common problem in small ruminant sector of Ethiopia.37

The percentage of SGP was 10.34% and 12.88% in sheep and goats, respectively, in Adama town, Oromia Regional State.34 According to Woldemeskel and Marsha,38 the prevalence of pox was 22% in sheep and 18% in goats in Wollo, Northeast Ethiopia. The seroprevalence between sheep and goat pox was 17% and 15.5%, respectively, in Northwest Amhara Region.2 According to Teshome,39 the prevalence was 40% in sheep and 8.12% in goats in Gondar University veterinary clinic. According to Molla et al,40 the prevalence was 31.96% in sheep and 35.28% in goats in Gamo Gofa zone of SNNRP. According to Kebede et al, the overall prevalence of small ruminant pox was 11.23%, out of which 12.9% were goats and 9.5% were sheep. The prevalence of sheep and goat pox in the country as well in the study area is pretty high; that is why the overall prevalence of pox lesions in the warehouse. Wounds and scars resulting from pox or tick infestations are the common pre-slaughter defects seen in pickled skins, and wet blue skins next to scratches, cockle, poor substance, and brandings.21

Conclusion

In this study, SGP was an important economical disease in the small ruminant sector as well as in the tanning sector. It causes a considerable loss due to decrement in skin grade. The percent loss in warehouses was very high.

SGP Interlayer Films Market Analysis 2021 to 2027 – Expectation Surges with Rising Demand and Changing Trends

]

The research report published by ResearchMoz on the SGP Interlayer Films Market provides a detailed overview of the demands and consumptions of various products/services associated with the growth dynamics of the market during the forecast period 2021– 2027. The in-depth market estimation of various opportunities in the segments is expressed in volumes and revenues. The insights and analytics on the SGP Interlayer Films Transformation Consulting Services market span several pages. These are covered in numerous sections, including, drivers and restraints, challenges and opportunities, regional segmentation and opportunity assessment, this report on the global SGP Interlayer Films market guarantees a fortune of data on a plenty of development opportunities in the market. The examination incorporates far reaching research by expert analysts. All the development factors influencing the SGP Interlayer Films market across the evaluation time of 2021-2027 have been systematically provided for the report. The exploration endeavors to introduce a gradual evaluation of the important buyers’ propositions targeted by different players and technologies that characterize the microeconomic conditions of the SGP Interlayer Films market.

The new report on the SGP Interlayer Films provides estimations of the size of the global market and share and size of key regional markets during the historical period of 2014 – 2018. The study provides projections of the opportunities and shares, both vis-à-vis value (US$Mn/Bn) and volume volume (n units), of various segments in the SGP Interlayer Films market during the forecast period of 2021 – 2027. The business intelligence study offers readers a granular assessment of key growth dynamics, promising avenues, and the competitive landscape of the SGP Interlayer Films market.

Get Free Sample PDF for Professional Insights: https://www.researchmoz.us/enquiry.php?type=S&repid=3235949

This report covers leading companies associated in SGP Interlayer Films market:

DuPont

PCII

Kuraray

Shenbo Glass

Huakai Plastic

Dongguan Qun’an Plastic Industrial

Scope of SGP Interlayer Films Market: The Global SGP Interlayer Films Market is valued at million US$ in 2017 and will reach million US$ by the end of 2025, growing at a CAGR of during 2018-2025. This Market Report includes drivers and restraints of the Global SGP Interlayer Films Market and their impact on each region during the forecast period. The report also comprises the study of current issues with consumers and opportunities. It also includes value chain analysis.

SGP Interlayer Films Market Segment by Applications, can be divided into

Automotive

Building & Construction

Photovoltaic

Other

Enquiry for Discount or to Get Customized [email protected] https://www.researchmoz.us/enquiry.php?type=D&repid=3235949

Market Segment by Type, covers

0.89mm Thickness

1.52mm Thickness

2.28mm Thickness

Market Segment by Regions, regional analysis covers

● North America (United States, Canada and Mexico)

● Europe (Germany, UK, France, Italy, Russia, Spain and Benelux)

● Asia Pacific (China, Japan, India, Southeast Asia and Australia)

● Latin America (Brazil, Argentina and Colombia)

● Middle East and Africa

Some of the most significant insights gathered through the business intelligence study on global SGP Interlayer Films market include:

Emerging end-use industries that can propel the market in coming years

Key regions and leading countries in global SGP Interlayer Films market

Changes in distribution networks brought on by the COVID-19 pandemic

Key consumer segments likely to drive demand in global SGP Interlayer Films market

Region-specific policy frameworks and regulatory guidelines

Lucrative opportunities for investments in various end-use industries and regional SGP Interlayer Films markets

Projected CAGR over the forecast period 2021 to 2027

Analysis of historic as well as recent consumer purchasing trends pertaining to global SGP Interlayer Films market

Technological advancements and product innovations with potential to revolutionize the SGP Interlayer Films market

Companies that held leading share in the market during the historic years

Get Assistance on this report @ https://www.researchmoz.us/enquiry.php?type=E&repid=3235949

About ResearchMoz

ResearchMoz is the one stop online destination to find and buy market research reports & Industry Analysis. We fulfil all your research needs spanning across industry verticals with our huge collection of market research reports. We provide our services to all sizes of organisations and across all industry verticals and markets. Our Research Coordinators have in-depth knowledge of reports as well as publishers and will assist you in making an informed decision by giving you unbiased and deep insights on which reports will satisfy your needs at the best price.

For More Information Kindly Contact:

ResearchMoz

90 State Street,

Albany NY,

United States – 12207

Tel: +1-518-621-2074

USA-Canada Toll Free: 866-997-4948

Email: [email protected]

Media Release: https://www.researchmoz.us/pressrelease

Follow me on : https://nextgenmarketresearch.blogspot.com/

Complex molecules from G. lucidum for cancer treatment

]

Introduction

G. lucidum is the dried fruit body of the polypore fungus G. lucidum Karst or Ganoderma sinense. G. lucidum has existed in China for thousands of years and is closely involved in the lives of the Chinese people, often being described as a kind of fairy grass that can cure various diseases.1 In a previous study, the medicinal history, cultivation methods, and species distribution of G. lucidum in China have been described in detail, filling the gaps for future research.2

Modern pharmacological studies have shown that G. lucidum contains a variety of bioactive components, including polysaccharides, nucleosides, furans, sterols, alkaloids, triterpenes, oils, various amino acids and proteins, enzymes, organic germanium, and many trace elements.3 Among them, G. lucidum polysaccharides (GLPs) and G. lucidum triterpenoids (GLTs) are the most important pharmacologically active substances. Recent studies have also highlighted the roles of GLPs in immune regulation and their hypoglycemic, hypolipidemic, anti-oxidant, anti-aging and anti-tumor effects.4 Moreover, GLTs have been found to purify blood and preserve liver function. Various Ganoderma preparations have sedative, anticonvulsant, anti-arrhythmic, anti-hypertensive and anti-tussive effects. In addition, G. lucidum displays anti-coagulant, anti-allergic, and platelet aggregation-inhibiting effects.5 The NIH3T3 cell line was employed to evaluate the cytotoxicity of G. lucidum using the XTT method, and no cytotoxicity related to the administration of G. lucidum was observed.6

G. lucidum is a safe, non-toxic, and widely used traditional Chinese medicine that is highly acknowledged by the world. GLPs and GLTs are the elite ingredients and are favored by researchers because of their high activity in G. lucidum. GLPs and GLTs have also showed remarkable biological effects.7 For example, they have been proven to play an effective role in cancer, neurodegenerative diseases, and diabetes, all of which are currently incurable diseases in humans.8,9 G. lucidum is extremely attractive to researchers, and it provides an in-depth explanation of its therapeutic effects on various cancers. Similarly, Rupeshkumar et al affirmed the magical power of G. lucidum from different angles.10

Currently, radiotherapy and chemotherapy represent the main outlets for cancer treatment in patients, but the side effects are also daunting.11 Maybe, the value of natural products shines exceptionally well. The flock of researchers focused their attention on whether they had the potential to change when combined with radiotherapy and chemotherapy. In a multitude of verification experiments, GLPs and GLTs have been shown to play versatile roles in responding to radiotherapy and chemotherapy, and they can be described as having full allure in future cancer research.12 Therefore, further research on polysaccharides and triterpenes, which are the elite components of G. lucidum, is urgent and valuable.

General Structure

GLPs are composed of three monosaccharide chains, possessing a helical stereo configuration similar to DNA and RNA. Among the more than 200 types of GLPs that have been isolated, in addition to glucose, most of them contain less monosaccharides such as arabinose, xylose, galactose, fucose, mannose, and rhamnose. Liu et al separated and purified GLPs from the fruiting body of G. lucidum, determining that the structure of the repeating unit is β-(1→3)-D-glucan as the main chain and β-(1→6)-D-glucopyranose as the side chain (Figure 1).

Figure 1 Structure of GLP isolated from G. lucidum. Note: Reprinted from Carbohydr Polym, 101, Liu Y, Zhang J, Tang Q, et al. Physicochemical characterization of a high molecular weight bioactive β-D-glucan from the fruiting bodies of Ganoderma lucidum. 968–974, Copyright (2014), with permission from Elsevier.45Abbreviation: Glcp, glucopyrano.

GLTs have 14 types of side chains and 7 types of original nuclei and have many different substituents, such as carboxyl, hydroxyl, ketone, methyl, methoxy, and acetyl groups. GLTs can be divided into C30, C27, and C24, depending on the number of carbon atoms present in the structure, and they can be further divided into classes based on the different functional groups and side chains, including acids, alcohols, aldehydes, and lactones (Figure 2 and Table 1).

Table 1 Species of GLTs

Figure 2 Common nuclei structures of GLTs.

Protective Effects of GLPs and GLTs on Radiotherapy and Chemotherapy

Radiotherapy and chemotherapy directly kill tumor cells and suppress tumor growth, representing the most important treatment options for malignant tumors. However, their side effects are unavoidable and harmful to human health and can lead to decreased gastrointestinal immune function and bone marrow suppression. In recent years, the emergence of natural products derived from traditional Chinese medicine has greatly enriched methods of tumor treatment and has quickly become a research hotspot, gradually evolving into a potential adjuvant therapy for tumor treatment. G. lucidum, which has existed in China for thousands of years, has proved to demonstrate resistance to radiotherapy and chemotherapy side effects. GLPs and GLTs are believed to play a crucial role in resisting radiotherapy and chemotherapy side effects.

The GLP Effects of Radiotherapy and Chemotherapy

Experiments with GLPs in Swiss albino mice showed that β-glucan (BG), a polysaccharide derived from G. lucidum, possessed a certain degree of protection against radiation and could effectively resist radiation-induced damage. In the control group receiving only radiotherapy, 80% of the animals died after receiving radiation for 20 days, while no mice in this group had survived by day 30. Before radiation, the mice were given BG at a dose of 500 μg/kg body weight (bw)/day, and the survival rates on days 20 and 20 were 66% and 33%, respectively. After radiotherapy, mice were given the same dose, but the results showed that the survival rates on days 25 and 30 were 83% and 66%, respectively. These results showed that the survival rate of mice treated with the same dose of BG was significantly higher than that before radiotherapy (P < 0.001), and they confirmed that administering BG at a dose of 500 mg/kg body weight (bw)/day was nontoxic.13

Radiotherapy and chemotherapy are effective methods for treating malignant tumors, but cancer is an expendable disease. As a possible consequence of radiotherapy and chemotherapy, chemotherapy-related fatigue is also an urgent problem to address. In a study on chemotherapy-related fatigue, a weight-loaded swimming test was used to assess the degree of fatigue in rats with A549 lung cancer cells, which showed that, compared to the control group, the duration of weight-loaded swimming in rats with GLPs was longer than that of the control group.14

In an interesting set of binding experiments, the combination of synthetic bismuth sulfide nanoparticles (BiNP) and GLPs presented new prospects in the development of radiotherapies. When combined with radiation, GLP-BiNP achieved a significant inhibitory effect on tumor growth through radio sensitization and immune activity, and mitigated the risk of bismuth nephrotoxicity. For future treatment prospects, this strategy shows huge potential.15 Similarly, the combination of gold nanocomposites and GLPs (GLP-Au) also has broad prospects.16

Paclitaxel (PTX) has become a broad-spectrum first-line chemotherapy drug due to its complex and novel chemical structure, unique biological mechanism of action, and reliable anti-cancer activity. According to research led by Su et al in 2018,17 the combination of G. lucidum spore polysaccharide (SGP) and PTX had incredible effects on tumor treatment. In preliminary studies of PTX in vitro, SGP did not increase the cytotoxicity of PTX. During the 21-day observation, the use of PTX alone in inhibiting tumor growth was effective from day 15, resulting in a reduction in tumor weight (p < 0.05). On the contrary, the inhibitory effect of PTX and SGP combination therapy on tumor growth might have occurred earlier. Additionally, experiments proved that the combined use of PTX and SGP could restore intestinal biological diseases caused by PTX monotherapy, and it helps to inhibit tumor metabolism, thereby inhibiting tumor growth. Another combination therapy of SGP and PTX was proven to ameliorate the intestinal barrier damage caused by PTX. The integrity of the small intestinal barrier of mice induced by PTX can be exceedingly adjusted by SGP. Intestinal injury caused by the use of PTX is closely correlated to the increase in epithelial permeability and the destruction of tight junctions. In view of the side effects of PTX, the combination of PTX and SGP for the protection of the small intestinal barrier damage caused by PTX may be accomplished by promoting the renewal of the intestinal epithelium to enhance the permeability and integrity of the epithelium. The mechanism involved may be related to the suppression of microtubule aggregates to inhibit cell proliferation and apoptosis18 (Figure 3).

Figure 3 A combined therapeutic effect of SGP and PTX. The combination of PTX and SGP can restore the small intestinal barrier damage caused by PTX treatment alone, which helps to inhibit tumor metabolism and ultimately inhibit tumor growth.

Another well-known side effect of chemotherapy is myelosuppression. A related study found that GLP could be used as a promoter for myelopoiesis to reduce the effects of myelosuppression induced by chemotherapy, thereby achieving protective effects on chemotherapy. It was recognized that GLPs do not directly stimulate the proliferation of hematopoietic progenitor cells to promote myelopoiesis, rather they indirectly stimulate splenocytes to produce hematopoietic growth factors (HGF), which mainly include granulocyte colony stimulating factor, interleukin-1, and interleukin-6, and stem cell factor19 (Figure 4).

Figure 4 GLP is a promoter of myelopoiesis. GLPs stimulate splenocytes to produce hematopoietic growth factors (HGF), which can act as a promoter of bone marrow production, reduce the bone marrow suppression induced by chemotherapy, and maximize the anti-tumor effect of chemotherapy.

The GLTs Effects of Radiotherapy and Chemotherapy

Smina et al reported that GLTs could strongly mitigate oxidation and scavenge free radicals, and they demonstrated the protective effects of GLTs on DNA and cell membranes after radiation damage using Thiobarbituric acid reactive substances (TBARS), comet assay, and micronucleus assay.20 Another study published by Smina et al revealed the potential therapeutic use of GLTs as an adjuvant in radiation therapy. GLTs were orally administered continuously for 14 days at doses of 50 and 100 mg/kg body weight (bw)/day before exposure of the whole body of Swiss albino mice to radiation. GLTs were shown to reduce the levels of lipid peroxidation and protein oxidation, effectively restore the activities of antioxidant enzymes and glutathione in the liver and brain of irradiated mice, and significantly reduce DNA strand breaks.21 It has also been reported that GLTs could be used as an alternative dietary supplement to prevent cancer-associated colitis.22

In a study using HeLa cells, GLTs and adriamycin displayed a synergistic effect that caused the regulated expression of 14 proteins that play significant roles in cell proliferation, the cell cycle, apoptosis, and oxidative stress. Furthermore, GLTs enhanced the production of reactive oxygen species (ROS) by adriamycin. It was suggested that the synergistic effect between GLTs and adriamycin may be based on the fact that GLTs enhance their sensitivity to chemotherapy by enhancing oxidative stress, DNA damage, and apoptosis23 (Figure 5).

Figure 5 Synergistic effect of GLTs and doxorubicin against chemotherapy sensitivity. The synergistic effect of GLT and adriamycin leads to the expression of multiple proteins, such as eIF5A, 14-3-3 β/α, and Ku80, which play important roles in cell proliferation, cell cycle, apoptosis, and oxidative stress, thereby enhancing the sensitivity to chemotherapy.

Experiments in HL-7702 cells found that GLTs were mainly concentrated in chloroform extracts, which exhibited significant inhibitory malignancy effects of cancer cells and on the repair or protection of normal cells damaged by radiotherapy and chemotherapy. These results showed that GLTs have protective effects against damaged normal cells induced by radiotherapy and chemotherapy.24

Research has shown that mycotherapy can improve the overall response rate during cancer treatment and reduce various chemotherapy-related adverse events. The GLT ganoderic acid A (GAA) was found to enforce QCT-induced apoptosis and Epstein-Barr virus (EBV) lytic reactivation at low concentrations, exhibiting similar biological effects to ganoderic lucidum extracts (GLE) in QCT-mediated antitumor activity. Thus, GAA can be used as a potential food adjunct for the prevention of EBV-associated gastric carcinoma (EBVaGC) development.25 Similarly, ganoderenic acid B (GAB) another type of GLTs could reverse the multidrug resistance of ABCB1-mediated liver cells to adriamycin, vincristine, and PTX, the mechanism of which may be due to the inhibition of ABCB1 transport and the increase in drug accumulation in MDR cells. GAB could also reverse the resistance of ABCB1-overexpressing MCF-7/ADR cells to doxorubicin.26

In addition, existing research shows that the Chinese medicinal herb complex (CCMH: a mixture of citronellol and extracts of G. lucidum, C. pilosula, and A. sinensis) increased the immune cell counts in cancer patients who received the treatment with chemotherapy and/or radiotherapy,27 which suggests that the Chinese medicinal herb has anti-radio-chemotherapy effects. Cao et al confirmed that G. lucidum and the immune system are inextricably linked in cancer treatment. It can activate immune cells, such as T or B lymphocytes, macrophages, and NK cells, and can also promote production of cytokines and antibodies, so as to achieve the purpose of inhibiting the growth of tumor cells.28

Ursolic acid is a naturally synthesized pentacyclic triterpenoid compound that has been widely found in various fruits and vegetables. It has not only demonstrated anti-cancer activities and anti-inflammatory effects but it has also been found to induce apoptosis in several human cancer cell lines. However, there is no clear evidence that there is an explicit limit to the use of ursolic acid in human studies.29 The compounds 2-cyano-3,12-dioxooleana-1,9(11)-dien-28-oic acid (CDDO) and its C28-modified derivative, methyl-ester (CDDO-Me), are two synthetic derivatives of oleanolic acid that have been widely studied for their ability to induce apoptosis and aid in the differentiation of cancer cells. Although some progress has been made in clinical trials, some complications related to heart failure events have been observed.30

Another study demonstrated that Escin, a mixture of triterpenoid saponins extracted from the horse chestnut tree, had anti-cancer effects. However, clinical trial results showed that some patients exhibited diarrhea, dyspnea, dysphagia, and corestenoma, while healthy volunteers did not have similar symptoms.31 Compared to Escin, GLTs play a significant therapeutic role in the treatment of numerous diseases. Among these triterpenes, it has been discovered that GLTs display anti-cancer effects, and most importantly, natural nontoxic effects.

Discussion and Outlook

In the modern treatment of cancer, radiotherapy and chemotherapy are important methods for the treatment of malignant tumors, which have the advantages of killing tumor cells and inhibiting the growth of tumor cells. Specifically, the electron beams, X-rays and radioisotopes show efficacy in most cancers. As a common chemotherapeutic drug, PTX and cisplatin are widely used in the treatment of various cancers through inhibiting cancer cell division, arresting DNA replication process of cancer cells, destroying cancer cell membrane structure, etc. Both radiotherapy and chemotherapy can directly kill cancer cells while simultaneously triggering tumor microenvironment remodeling in which pro-inflammatory signaling pathways are activated and pro-inflammatory mediators are released, thereby recruiting tumor-infiltrating immune cells.

GLPs and GLTs are of the essence of G. lucidum, and have proved to play multi-faceted anti-cancer roles including direct cytotoxicity in tumor cells, antioxidant effect, inhibition of angiogenesis, induction of cell differentiation and immunomodulatory effect (activation of immune host response), etc. Currently, the clinical trials of GLPs and GLTs are under way. Polysaccharide extracts (Ganopoly) stimulate immune responses in advanced stage cancer patients. IL-2, IL-6, IFN-γ and NK cell activity in plasma were increased, while IL-1 and TNF-α were considerably reduced.32–34 Early research on G. lucidum against leukemia indicated that it is an ideal leukemia treatment drug, and its underlying mechanism may be that G. lucidum induces the differentiation of leukemia cells to the mature stage and inhibits their proliferation.35 In various nonrandomized clinical trials of different types of cancer, especially breast cancer, when combined with radiotherapy or chemotherapy, polysaccharide extracts of G. lucidum could be very efficient to reduce the metastasis potential and/or adverse effects, and enhance the effects of chemotherapy and radiotherapy.36–40 Therefore, combination therapy with GLPs/GLTs and radio-chemotherapy is becoming a general trend clinically, which can achieve the goal of increasing efficiency and reducing the side effects caused by drugs (Figure 6).

Figure 6 The synergistic model of GLP and GLTs with chemotherapy and radiotherapy. Combination treatment of GLP/GLTs and chemo-radiotherapy showed synergistic effects in lung cancer, breast cancer and colorectal cancer treatments with ameliorating side effects such as gastrointestinal reactions and myelosuppression.

Future directions should focus on the molecular elaboration of GLPs and GLTs in cancer research. It is important to clarify the β-glucan contents in GLPs or SGP, also critical to decipher the structure and biological functions of these β-glucan in GLPs including the immunomodulatory mechanisms. The pharmacodynamics of GLPs in vivo is also important for future clinical translation. In addition, though the elite components of the G. lucidum are GLPs and GLTs, other components such as unsaturated long-chain fatty acids, appear to show the antitumoral activity. Elucidating the antitumor activity of G. lucidum has a great potential in improving human health and curing diseases.