Impact of sheep and goat pox lesions on skin quality

Impact of sheep and goat pox lesions on skin quality

]

Introduction

Ethiopia has a huge livestock population in Africa, possessing more than 56.7 million cattle, 29.3 million sheep, 29.1 million goats, 1.5 million camels, 7 million equines and 52 million chickens.1 This makes Ethiopia stand second next to Nigeria, by the number of small ruminants in Africa.2 Annually, 16.6 million small ruminant skins are produced in the country, among these 33% and 32.5% were obtained from sheep and goats, respectively.3 Despite a huge potential of off take rates; the production of high-quality skins was curtailed.4,5

Fish, birds, and reptiles, as well as wild and domesticated animals, can provide hides and skins. Cattle, sheep, and goats are the most important sources of hide and skin in Ethiopia. In 1998/99, the potential production is projected to 2.38 million cow hides, 10.07 million sheep skins, and 7.38 million goatskins based on annual off-take rates of 7% for cattle, 33% for sheep, and 35% for goats. This leather industry’s raw material is mostly obtained from rural parts of the country where basic facilities for slaughtering and subsequent marketing are either non-existent or non-existent. Hide obtained from cattle, as well as skins obtained from goats and sheep, are country’s major items that account for the vast majority of agricultural export commodities followed by live animals.6

Sheep and goats play a substantial role in the gross domestic product of the countryto date, the benefits gained from these small ruminants are fraught by different constraints. Livestock diseases are amongst the significant practical precincts that have slowed down the progress of the livestock sector by decreasing production and impeding the trade of live animal and animal products.7,8 Among these infectious diseases, sheep and goat pox are the main problem and widely spread diseases in all regions of Ethiopia.2

More than 35% of sheep and 56% of goat skins have downgraded and rejected due to pre- and post-slaughter defects. The majority of defects are caused by pre- and post-slaughter defects due to skin diseases and poor because of various antemortem and postmortem defects caused by poor animal husbandry and nutrition, skin diseases and parasites, improper slaughter and flaying operations and improper practices of curing, collection, transportation and storage.9 Tanneries state that only 10% to 15% of harvested skins qualify for top grades, with the rest downgraded and rejected mainly due to deterioration of skin quality owing to skin diseases and various defects.10 Sheep and goat pox is among the disease which is responsible for deterioration of the quality of skin.

Sheep and goat pox virus (SGPV) is highly contagious viral disease of sheep and goats, in the genus Capripox virus (CaPV), subfamily Chordopoxvirinae, and family Poxviridae.11 The sheep pox virus (SPPV), goat pox virus (GTPV), and lumpy skin disease virus (LSDV) showed 96% nucleotide and amino acid similarity over their entire length.12 The central genomic region surrounded by two identical inverted terminal repeats (ITR) at the ends of SGPV (ORFs 024 to 123) comprises homologues of conserved genes involved in basic replication systems as well as in viral DNA replication, transcription, RNA modification, and structure and assembly of intracellular mature and extracellular enveloped virions.12–14 While the terminal open reading frame (ORF) (001 to 023 and 124 to156) contain genes involving with virulence, host immune evasion and host range functions.12 Mature virion cell attachment (P32) comprises the main antigenic determinants which are important for the pathogenicity and diagnosis of the virus.15

In endemic areas losses due to SGP include the direct loss; mortality, and the indirect losses include reduced milk yield, weight loss, increased abortion rates, damage to skin, and increased susceptibility to pneumonia and fly strike.16

The effect of SGPV on the skin is very high. Lesions developed secondary to virus invasion of the epithelium, ischemic necrosis produced by vascular damage and stimulates the host cell DNA replication which causes epidermal hyperplasia.17 The epidermis shows hydropic degeneration and ruptured vesicles at some places exposing the dermis.18 Edema, fibroblast proliferation, and accumulation of cellular exudates in the stained section of the dermis.19 Extravasations of erythrocytes and coagulative necrosis with effusion of inflammatory cells intermixed with tissue debris was noticed in the hypodermis.18 The impact of these pathogenesis mechanisms of the virus may also affect the tannery industry in countries like Ethiopia where leather is the largest source of foreign currency. Now days, the current foreign trade revenue of hide and skin has dropped by 9–10% on domestic and export markets.20 In Ethiopia, it is projected that a higher proportion of skin defects are developed ante-mortem.5,21 Among infectious diseases, sheep and goat pox are the major trait for the small ruminant sector and the second largest cause of skin rejection next to parasitic causes.22 Skin grades on skin collected from different areas of Ethiopia showed that greater than 85% hide was rejected due to pox and less than 6% was graded 1–4.22 The main aim of this research is to assess the impact of SGP in warehouses and the quality impacts of SGP on skin in ware houses.

Materials and Methods

Study Area

The research was conducted in West Shewa, East and west Arsi. Arsi Negele is located in the west Arsi zone of Oromia regional state. Arsi Negele is located at a longitude of 7°21ʹ N and latitude of 38°42ʹE and 2043 meters above sea level. Ziway is located at the longitude of 7°56ʹ N and latitude of 38°43ʹ E and 1636 meters above sea level. Dhera is located 30 Km away from Adama on the highway connecting Adama to Assela. Dhera is located at the longitude of 8°15ʹ N and latitude of 39°20ʹ E and 2430 meters above sea level1 (CSA, 2015). These areas receive bimodal rainfall and local farmers practice rain feed agriculture and also practice irrigation.

Sample Size

A cluster sampling method was applied to identify skin defects from skins collected from three districts. Sample size was estimated according to Thrusfield,23 the sample size was 384 where an expected prevalence of 50% is to be estimated with a desired absolute precision of ±5%. To maximize the accuracy of the data produced by the survey, we sampled more than the average.

Study Design

Three (each with a potential of collecting >5000 skins per annum) private skin collection shades/stores were purposively selected based on proximity to the transport access. Twenty percent of the warehouses’ sheep and goat skins (fresh, salted or air-dried skins) were selected using a simple random sampling method. Complete physical examination was performed on randomly selected skins and data were recorded to generate information related to sheep and goat pox like; distribution of the lesion, lesion type, size, and skin grade. The skin was categorized by size, preservation methods (fresh, salted, and air dried) and skin defects caused by sheep and goat pox.24 Skin inspection was made by day light to check for any defects.

Laboratory Examination

Skin biopsies for virus genome detection were collected from skin lesions and placed in a sterile screw-capped test tubes and placed immediately on an icebox and then in –20°C and sent to the department of Molecular biology in National Veterinary Institute (NVI), Ethiopia, for molecular diagnosis.25 Skin tissues were rinsed with phosphate buffered saline 3 times. Skin tissues were analyzed, minced with a sterile scissor and crushed with a sterile pestle and mortar as described by Mangana-Vougiouka et al.26,27 The viral genomic DNA extraction was done using the QIAamp DNA Mini Kit (QIAGEN, Hilden, Germany) using the manufacturer’s instructions as a base and finally the DNA was eluted using 50μL elution buffer. The PCR was conducted using RNA polymerase 30KDa (RPO30) primers: Forward primer 5ʹ TCTATGTTCTTGATATGTGGTGGTAG 3ʹ and Reverse primer 5ʹ AGTGATTAGGTGGTGTATTATTTTCC 3ʹ. Polymerase chain reaction (PCR) was carried out in a 25μL reaction volume in a 200μL capacity PCR tube containing 12.5μLMaxima Hot Start Green PCR Master Mix (QIAGEN, Hilden, Germany), 0.5μL of each primer (10pmol/μL), 1μL of extracted DNA and 10.5μL of nuclease free water. The amplification was performed according to Lamien et al28 in a thermocycler (Eppendorf AG, Hamburg, Germany) adjusted as denaturation (95°C for 4 min), followed by 35 cycles of denaturation (95°C for 30 sec), annealing (55°C for 30 sec) and extension (72°C for 30 sec) and final extension (72°C for 5 min). Three percent ultrapure, electrophoresis grade agarose gel containing 1μg/mL Ethidium Bromide in TAE buffer, was prepared and casted in a mold. When the gel was completely solidified, the combs was removed carefully and the gel was placed in the electrophoresis tank containing 1X TAE running buffer before loading the samples. In the centre of the first well, 5μL of 100bp DNA ladder was loaded, while in the remaining wells, 6μL of sample DNA with 2μL of DNA loading dye (50% glycerol, 6x TAE, 1% bromophenol blue) was loaded by using micropipettes. After electrophoresis on 3% agarose gel (1hr at 100V) the PCR product was visualized on a UV Transilluminator (UVtec, Cambridge, UK).

Data Analysis

The data was collected by a pretested questionnaire and filled in a spread sheet Excel analysis was by using SPSS version 24 (SPSS. Inc.) and a significant association between variables was said to exist if the computed P-value is ≤0.05. Student’s t-test was applied to see the difference between species, preservatives used and study area.

Results

A total of 2014 skins (998 sheep skin and 1016 goat skin) were examined during the study period (Table 1). The prevalence of SGP in warehouse was 4.02% (n= 81). The vast majority of the SPG lesions were scars (n=45), followed by nodules and papule (n=19) and (n=13), respectively. According to Ethiopian Standard Authority (ESA, 2012), only a small proportion of shoat skins drop in the extra small (1%), very small (11.56%), and extra-large category (0.145%). Large proportion of shoat skin were categorized under the small (21.6%), medium (31.1%), large (25.76%), and very large (8.6%) categories.

Table 1 The Distribution of SGP in Terms of Spp., Size, Study Area, Preservation and Lesion Types

Despite a large number of SGP, positive skins fall in small, medium, and large categories; there was no substantial variance between different sizes and SGP (P.0.05) as shown in table. However, there was a significant difference between species (χ2=8.314; P=0.016) and study area (χ2=53.647; P=0.000).

As depicted in Table 2 SGP was responsible for an epic downgrading of skin (n= 27, 1.3% fall in grade 5) and rejection of skin (n=21, 1%), and usually a large proportion of the affected skin fall in grades 4, 5, 6 and reject category. Among rejected skins (n=79), 25% was due to SGP (Table 2). Furthermore, there is a strong correlation and association between skin down grading and SGP (P < 0.05).

Table 2 The Impact of SGP on the Total Grade of the Skin

All samples, whether it was collected from sheep or goat, were given a 172 bp sized DNA product during RPO30 gene amplification. All samples, whether it was collected from sheep or goat, were given a 172bp sized DNA product during RPO30 gene amplification. RPO30 gene of SPPV has 151bp size while the GTPV and LSDV have 172bp size.

Discussion

A lot of works done on skin quality fail to describe problems that can downgrade skin quality infectious diseases like sheep and goat pox (SGP). This study discloses the most significant aspects of SGP in the quality of skin in warehouses.29 Epithelial regeneration from the underneath of the scab takes several weeks. The disease causes irreversible damage to the skin and a star-shaped, hairless or wool less scar is formed. The scar affects the grain side of the skin.30

The total prevalence of SGP in warehouses in this study was 4.02%; 2.28% and 1.69% of the pox lesion was observed on fresh skin and salted skin, respectively. Our finding is in line with other findings.21,31 Kahsay et al21 documented that the prevalence of SGP in salted skin and dry skin was 15% and 6.8%, respectively. While Tsigab et al31 reported that the prevalence of pox lesion was 3.6% and 4% in dry skin and wet skin, respectively. Pox lesions were observed more often on wet blue goat skins (10.8%) and wet blue hides (8.1%) than in pickled sheep skins (1.2%).21

In Tannery-based studies conducted in Bahirdar tannery and Modjo export tannery, the prevalence of SGP was 10%32 and 9.5%.33 Usually, the prevalence of SGP lesions in tanneries is by far larger than that of warehouses. After the tanning process, fully recovered lesions become more protuberant in the form of white spots on the skin and usually confusing Cokkel scars.30

In Ethiopia, very limited work has been done on sheep and goat pox virus but some researches have been made on participatory disease surveillance (PDS) in selected districts of Afar region and Northeastern part of Ethiopia and central Ethiopia Gari et al34 and seroprevalence and distribution of sheep and goat pox virus in Northwest Amhara region Ethiopia were reported by Fentie et al.2 Furthermore, isolation and characterization of poxvirus was done by Demena35 in west Shoa and central Ethiopia. A report on epidemiology and economic importance of sheep and goat pox is highly distributed in all regions of Ethiopia and economically important due to production loss and mortality.8,2

According to Assefa et al,32 large and very large skins are highly affected and 90% of the affected skin classified in the reject category. However, in our study, a substantial number of skin fell in grade 2, 4, and rejected category (69.13%). A study conducted in Punjab, Pakistan, old lesions of pox are the second largest skin and hide problem followed by skin atrophy.19 However, in our study, the proportion of SGP was 4.02%. Pox accounted for 1.5%, 15.5%, 6.8% and 8.3% of pickled sheep skins, wet blue or salted goat skins, wet blue or dry goat skins and wet blue hides, respectively, being rejected.21

Sheep and goat pox (SGP) is a highly transmissible viral disease that results in an extensive loss in the production and productivity of small ruminants in Ethiopia. Regarding the status of the disease in Ethiopia, SGP was endemic in almost all the regions of Ethiopia.34,35 In Ethiopia, a total of 57,638 small ruminants contracted the disease and more than 4.8 million of them were at risk in areas where outbreaks occurred. Out of the 57,638 sick small ruminants, 6,401 animals died with a case fatality rate of 11.11%. Only about 35–40% the disease was reported in Ethiopia; the actual figures in terms of affected, vaccinated and dead animals are expected to be higher than the reported numbers. Although there were no detailed studies on the prevalence of SGP in Ethiopia, some reports indicate that it is one of the widely distributed and it is the common problem in small ruminant sector of Ethiopia.37

The percentage of SGP was 10.34% and 12.88% in sheep and goats, respectively, in Adama town, Oromia Regional State.34 According to Woldemeskel and Marsha,38 the prevalence of pox was 22% in sheep and 18% in goats in Wollo, Northeast Ethiopia. The seroprevalence between sheep and goat pox was 17% and 15.5%, respectively, in Northwest Amhara Region.2 According to Teshome,39 the prevalence was 40% in sheep and 8.12% in goats in Gondar University veterinary clinic. According to Molla et al,40 the prevalence was 31.96% in sheep and 35.28% in goats in Gamo Gofa zone of SNNRP. According to Kebede et al, the overall prevalence of small ruminant pox was 11.23%, out of which 12.9% were goats and 9.5% were sheep. The prevalence of sheep and goat pox in the country as well in the study area is pretty high; that is why the overall prevalence of pox lesions in the warehouse. Wounds and scars resulting from pox or tick infestations are the common pre-slaughter defects seen in pickled skins, and wet blue skins next to scratches, cockle, poor substance, and brandings.21

Conclusion

In this study, SGP was an important economical disease in the small ruminant sector as well as in the tanning sector. It causes a considerable loss due to decrement in skin grade. The percent loss in warehouses was very high.

Research debunks myth that COVID vaccination promotes mutations

]

A study conducted by researchers at the University of Maryland, USA, has highlighted the importance of coronavirus disease 2019 (COVID-19) vaccination in reducing the frequency of mutations in the delta variant of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2). The study also presents an evolutionary algorithm that can accurately predict new COVID-19 outbreaks. A detailed description of the study is currently available on the medRxiv* preprint server.

Background

Currently, the best possible way to end the COVID-19 pandemic is mass vaccination. However, public distrust and hesitancy to accept COVID-19 vaccines have added an extra level of complicacy in combating the global spread of SARS-CoV-2. Despite proven efficacy against SARS-CoV-2 infections, a large proportion of the global population is still uncertain about the risk-benefit ratio of COVID-19 vaccines.

In addition to increasing the risk of viral transmission, under-vaccination may affect the rate of viral mutations. On average, the mutation rate of SARS-CoV-2 is 7.23 mutations per viral sample. Mutations that emerged under positive selection pressure, such as vaccine/therapy-induced immunity, are the main driving force of viral evolution. Thus, novel viral variants evolving during the pandemic are likely to develop resistance against vaccines and therapeutics.

In the current study, the scientists have explored the association between vaccine coverage rate and mutation frequency of the SARS-CoV-2 delta variant (B.1.617.2).

For the analysis, they have collected complete genome sequences of SARS-CoV-2 from the Global Initiative on Sharing All Influenza Data (GISAID) database. In total, viral sequences from 20 countries have been included in the analysis.

(A) Correlation between full vaccinated rate [13] and mutation frequency (Mf) from June 20 to July 3 2021 in 20 countries: Australia (AUS), France (FRA), Germany (GER), Indonesia (IDA), India (IND), Ireland (IRL), Israel (ISR), Italy (ITA), Japan (JPN), Mexico (MEX), Netherland (NED), Norway (NOR), Portugal (POR), Singapore (SGP), Spain (ESP), Switzerland (SUI), Sweden (SWE), Turkey (TUR), United States (USA), and UK. Logarithmic regression (solid) line was draw based on 16 countries (pink dots) with a calculated 95% confidence interval (dashed lines). Japan, Switzerland, USA, and Australia are labeled in different colors as outliers. (B and C) Chronology of nucleotide diversity (π) (B) and Tajima D’ value (C) of SARS CoV-2 delta variants in UK (N=27,344, blue), Indian (N=4,451, red), and Australian (N=305, green). Data were plotted every two weeks, and the data only represent the effective population size with more than 3 high quality sequences. The arrows label the epidemiological events of COVID-19 delta variants announced by the World Health Organization (WHO). WHO classified the delta variant as a global variant of interest (VOI) on 4 April 2021, and variants of concern (VOC) on 11 May 2021 [5]. The dashed line in (C) labels the cut-off threshold -2.50 in Tajima D’ test.

Important observations

The analysis revealed that with an increase in vaccination rate, there is a reduction in the frequency of viral mutations. This inverse correlation between vaccination rate and mutation frequency was observed in 16 out of 20 countries.

As an exception, Australia exhibited a very low mutation frequency with a vaccination rate of around 10%. In contrast, a high mutation frequency was observed in the United States, Japan, and Switzerland, despite higher vaccination rates than in Australia. These observations indicate more successful implementation of control measures in Australia than in these countries.

Prediction of new outbreaks

To determine whether vaccine-induced immunity acts as a positive selection pressure to initiate viral evolution, the scientists analyzed genome sequences of the delta variant in the UK, India, and Australia. They performed the Tajima D test to determine whether mutations emerge neutrally or via non-random processes, including directional selection or demographic expansion. Tajima’s D is a statistical test used in population genetics to compare pair-wise genetic diversity and total polymorphism to deduce selection and demographic events.

The findings of the Tajima D test revealed that the delta variants in the UK emerged with rapid clonal expansion. In contrast, the variants in India and Australia mainly emerged with singleton mutations (single nucleotide variants). The values obtained from the Tajima D test were between -2.68 and -2.84 for all the delta variants. These D’ values were equivalent to that calculated from the sequences of B.1.1.7 variant in the UK during the study period. Negative D’ values observed in both the UK and Indian variants throughout the study period indicate more substantial demographic expansion or positive selection.

With further analysis, the scientists observed that new COVID-19 outbreaks occurred in the UK and India 1 – 3 weeks after the reduction of D’ values below -2.50. Based on these findings, they proposed that a D’ value of -2.50 could be used as a threshold to predict new outbreaks.

Study significance

The study reveals that the frequency of viral mutations can be reduced by increasing the rate of full vaccination. In other words, countries with high vaccine coverage are less likely to experience new COVID-19 outbreaks. Thus, public hesitancy to COVID-19 vaccination could potentially lead to the emergence of more pathogenic viral variants and failure to achieve herd immunity.

As recommended by the scientists, mass vaccination, control measure implementation, and continuous genomic surveillance are the most vital strategies to combat the COVID-19 pandemic.

*Important Notice

medRxiv publishes preliminary scientific reports that are not peer-reviewed and, therefore, should not be regarded as conclusive, guide clinical practice/health-related behavior, or treated as established information.

Press Release: 10 Landmark Moments in Climate Change Law

]

In the scientific and popular lexicon, “climate change” can be traced back to a 1975 paper by geochemist Wallace Broecker and a 1979 report by the National Academy of Science. These two papers paired the term with another that would rise in prominence throughout the 1980s and 1990s, “global warming,” to alternately discuss a holistic set of changes that may occur alongside a rise in carbon dioxide in the atmosphere and the surface-level increase in temperature that was being observed and projected at the time.[1]

Since the 1970s, an increasingly complex legal apparatus has grown to keep pace with our understanding of the realities of global climate change. For an overview of this vital area of debate, regulation and legislative action, take a look at these 10 significant moments in the evolution of climate change law. Every professional working in the field of environmental law should be familiar with both these landmark legislative achievements of the past and the forward-looking regulations being put in place today to help avoid climate catastrophe and preserve a livable planet for future generations.

First Steps: The Clean Air Act

While not written explicitly with climate change in mind, the 1963 Clean Air Act has proved a flexible law that has seen its powers expanded several times to allow it to cover pollution in addition to that which directly impacts people’s health. It was drafted with general authorities to address pollution challenges that would emerge over time after its passing, which enabled it to be adapted to regulate climate-altering emissions. In particular, 1970, 1977 and 1990 amendments to the act have expanded its regulating authority and positioned it as a key policy in the fight against climate change.[2]

Renewable Energy Legislation

One of the most important ways in which climate change can potentially be curtailed is through the adoption of renewable energy sources to replace conventional fossil fuels. The promotion of renewable energy has been a topic of debate in the U.S. congress for decades, dating back at least as far as 1992, when the Senate adopted the U.N. Framework Convention on Climate change and a renewable energy production tax credit was included in the Energy Policy Act. This tax credit has been periodically extended, and an investment tax credit for solar energy installations was included 13 years later in the 2005 Energy Policy Act.[3]

Protracted Debate over the Kyoto Protocol

The 1997 Kyoto Protocol was a pivotal moment in global climate change regulation, as it marked the first time the world’s leading carbon-producing nations gathered together to devise a collective strategy. While the Clinton administration successfully agreed to a plan for capping and trading carbon emissions, the treaty was met with stark resistance in congress back home. Efforts to gain legislative approval of the treaty stalled in subsequent years without stipulations included that would require developing nations to follow the same guidelines as the initial signatories.[4] The entire saga proved a lesson about the importance of the executive and legislative branches working together to create actionable climate change policy.

The Greenhouse Gas Reporting Program

Created as part of an appropriations bill in 2007, the Greenhouse Gas Reporting Program mandates reporting of greenhouse gas data and related information from large producers of emissions, fuel and industrial gas suppliers, and other related organizations and institutions in the U.S. While it does not have any sort of enforcement mechanism attached to it, the program supports the maintenance of a publicly available database that can be used to pressure highly polluting corporations and inform state- and local-level regulations.[5]

National Flood Insurance Program Responds to Climate Change

While the National Flood Insurance Program dates back to the 1968 National Flood Insurance Act, it has gained importance in recent years as catastrophic weather events and rising waters as a result of climate change have increasingly threatened coastal areas. The program is the primary source of flood insurance for residential properties in the U.S., and it has been extended multiple times since 2012. However, it is set to expire in September 2021 without action from congress, setting the stage for a crucial climate change policy debate with immediate potential impact.[6]

The Paris Climate Agreement: An Ongoing Saga

The U.S. was one of nearly 200 nations to sign the Paris Climate Agreement in or after 2016, pledging to limit carbon emissions in an attempt to keep global warming limited to under 2 degrees Celsius compared to pre-industrial average temperatures. But this major action at the tail end of the Obama administration was immediately reversed by the Trump administration, with an initial pledge to withdraw from the deal in 2017 followed by formal withdrawal in 2019. In early 2021, President Joe Biden reversed course once again immediately after taking office, rejoining the agreement as one of the first major acts of his administration.[7] As one of the leading carbon producers in the world, the U.S.’s participation in the agreement has a significant impact on its potential success or failure.

Climate Change Policy in the December 2020 COVID Relief Bill

At the end of a year ravaged by a global pandemic, congress passed an omnibus bill predominantly intended to offer relief to businesses and communities impacted by the virus but containing a number of other unrelated provisions. Several of these latter elements combine to form a quite significant climate change policy doctrine, including formal limitations on the production of HFC refrigerants, a new directive for the Department of Energy to promote funding for renewable energy and modernization of energy infrastructures and storage systems to promote increased efficiency.[8]

Climate Change in President Biden’s Infrastructure Plan

The Biden Administration appears serious about legislatively dealing with the realities of climate change, seeking to write into law significant provisions to curtail greenhouse gas emissions as part of an ambitious $2 trillion infrastructure package. These include a measure called the American Jobs Plan which contains $174 billion earmarked for promoting the electric vehicle market, $1 billion for upgrades to the national infrastructure to avoid disastrous climate-related failures like those that occurred in Texas in 2021 and a new “Energy Efficiency and Clean Electricity Standard” that would require that a portion of electricity in the country come from zero-carbon sources like solar and wind power.[9] While the proposal faces an uphill battle to make it through congress and will almost surely be modified along the way, it signals a bold step toward addressing the ongoing crisis through every available avenue.

State-Level Climate Change Policy

Because the Trump administration largely pursued a path of deregulation regarding climate change initiatives, the onus to pass meaningful climate policy largely fell on states over the past several years. By 2020, 12 states had committed to pursue 100% clean energy policies, joined by municipal and local governments in many more states. Other examples of recent state-level policy include the Virginia Clean Economy Act, which provides money for energy efficiency upgrades for low-income communities, the 2019 New York Climate Leadership and Community Protection Act, which requires net-zero statewide carbon emissions by 2050 and ensures that future state policies will not burden environmental justice communities, and discounts or financial incentives for farmers in Iowa and Nebraska who maintain cover crop practices to offset carbon emissions and promote healthier soil.[10]

A Model for Future Climate Change Law in New Zealand

In April 2021, New Zealand became the first nation to introduce climate change laws pertaining to financial firms rather than industrial firms or other actual polluters. This law requires banks, insurers and investment managers to monitor and report the impacts their businesses have on carbon emissions and climate change.[11] It is a bold step toward a wider reaching climate policy that will hold all responsible parties accountable for climate-impacting activity, and one that could be replicated across the globe in the coming years.

Keep Up With the Latest in Climate Change Policy at Tulane Law School

If you work in an environmentally regulated industry, an NGO or another organization engaged with environmental policy and energy law, the online Master of Jurisprudence in Environmental Law and online Master of Jurisprudence in Energy Law from Tulane University Law School can prepare you to thrive in your current role or pivot toward a new challenge.

[1] Retrieved on April 19. 2021 from nasa.gov/topics/earth/features/climate_by_any_other_name.html

[2] Retrieved on April 19, 2021 from epa.gov/sites/production/files/2015-05/documents/caa_nutshell.pdf

[3] Retrieved on April 19, 2021 from c2es.org/content/congress-climate-history/

[4] Retrieved on April 19, 2021 from fivethirtyeight.com/features/a-lesson-from-kyotos-failure-dont-let-congress-touch-a-climate-deal/

[5] Retrieved on April 19, 2021 from epa.gov/ghgreporting/learn-about-greenhouse-gas-reporting-program-ghgrp

[6] Retrieved on April 19, 2021 from fas.org/sgp/crs/homesec/IN10835.pdf

[7] Retrieved on April 19, 2021 from npr.org/2021/02/19/969387323/u-s-officially-rejoins-paris-agreement-on-climate-change

[8] Retrieved on April 19, 2021 from arstechnica.com/science/2020/12/heres-the-energy-and-environment-policy-passed-with-the-relief-bill/

[9] Retrieved on April 19, 2021 from cnbc.com/2021/03/31/biden-infrastructure-plan-spending-on-climate-change-clean-energy.html

[10] Retrieved on April 19, 2021 from americanprogress.org/issues/green/reports/2020/04/30/484163/states-laying-road-map-climate-leadership/

[11] Retrieved on April 19, 2021 from reuters.com/business/sustainable-business/new-zealand-introduces-climate-change-law-financial-firms-world-first-2021-04-12/